EST 1210180 is a singleton


Sequence

>1210180 (1 EST) Length=302 CTTAATTGATCTTTACCATCATGTGGTATGAAATTATTCCATCGATTGCAATAGTAGCCGGAATAACATTTGCGCTCCCA CCTTTAATAAGCGTGACCAGTTATGCATGTTTTGGCAGATGGAATCCACCTGGTTTATTTCGGTTTAAACAAGATTTCTN CCTACATTTACGTGATAAAGATCTTGAAGGACCNCTTTTATTTCAAGACTCAGAGTTTATCTTCAAGGATTAACCAAATT GGTTGTTGACTGATNTGTGTAACTTGATGTANATTTTAGCAAAAATAAAAATGTTGATTTAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1210180: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12101802330469AA559773MC210218.NA3TBRI-Saber-cercaria-A


Date: 23:30:59 on Fri 17 Nov 117.