EST 1210181 is a singleton


Sequence

>1210181 (1 EST) Length=341 CTTTTATCGTCACAGTGCAGAAAATTCAACGACTGNAATTTATTATAAAGNAATGCATTAAAACTTCAAGATGATCAAGC TGCATTATCTGCATCTATGTTATGTCCGAAACGACCAACTGCTGCGAAGCATNTTGATGAAAGCTCTGCTAATGCCAGAT TACTTGAAGCATTAGCTGCTGAGGCGGCTGCCTTACAGCAAAATGAAGCATCGAATAACGCCCCATTGCGCCGAAGTGTT CAACAACAAGAAACTACTCAAGGCATTGATACCGCTGTCNCTGTTTCTACTATTGGAAGATGAAGAAGAGGAAGCCGAAG CAAAAGAAATAGCAGATTCGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1210181: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12101812330470AA559774MC210219.NA3TBRI-Saber-cercaria-A


Date: 19:12:0 on Fri 24 Nov 117.