EST 1210191 is a singleton


Sequence

>1210191 (1 EST) Length=444 AATTCGGACNANAGTANCTGTCTACACTGGAAACAATTTGTTACTCTTCGCGCAAACGTGCGAGTTTCTAACCATGATGA TCCGAAGTAAAACAAAAATGGGCCTCTCTTACATTGCTAATAAATTATGGACATGTTATATCAAAAATTGCTGTTGGGGA CCGCTACTCCTTTATGGAGTACTGGTCTCGTCTCACCACTTTACGCTATCATAACTGATACNCCCGTCAAAACTGGGTGC TCAGACGTATTGGGCAGTTGTGAAAGTCCTGGCAGTTGTTCTGACTTCTTATCTGACATATCAACAAGCCGAAGCCCGGA TTCTGGGANANATTGTAACTCNCANCATTTCTGATTTTGTGCCCACANGANGTTCCTTGAATTTTGTTNGCTGANTACTC CGGCACCCCCCTTTCANAAGNCGGAACACTGAAGTTTCCGTTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1210191: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12101912330480AA559784MC210274.NA3TBRI-Saber-cercaria-A


Date: 10:29:20 on Sat 18 Nov 117.