EST 1210202 is a singleton


Sequence

>1210202 (1 EST) Length=305 TTCCATCTCTGTAACTTTTTTGCTGTCAGGATTTCCGTTCGCGATAATCGTTTCCTAAAACTAAATAATTTACTGCTCGC TAANACCTTTTGATTATGTCTGAAGTATCTCTNCTCCATGCGTCACCTTTTATTGCTTTGCCATTTGTTGGAGCNTTTGT TGGACANAGGATTGTTTCTAAAAATATGTACTGGTATGATACTTTGAGAAAGCCATCGTTCTCACCTCCCAAATGGGTTT TTGGACCAGTTTGGAGTGCACTTTATGGTTGCATGGGAGCTGCGTCCNATCTGGTATGGANAGAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1210202: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12102022330491AA559795MC250457.NA3TBRI-Saber-cercaria-A


Date: 19:19:38 on Wed 22 Nov 117.