EST 1210205 is a singleton


Sequence

>1210205 (1 EST) Length=140 TGGAATTTCATTTAAATTTCGGTATTGTAGTTGTACTTGTTTTAAACCGTGAAAACGTCTTTTACTATTAAATGATAAAC CCAAAACTAGATTTTACTGTGCTTCATTTGTATTCGGTTAATAAAGGCTTTTTCATATTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1210205: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12102052330494AA559798MC250462.NA3TBRI-Saber-cercaria-A


Date: 10:44:13 on Tue 21 Nov 117.