EST 1210211 is a singleton


Sequence

>1210211 (1 EST) Length=321 ATTCATCTCGTTTATTAGCCCAGATAGGAGATACTGGAGTGATAGCTGTTCTTTCTCAAGTTATTGAAGATCTCATTCAT GGTGAAATGATGCAGCTTGCACCCAACAGCGATGATGATGACAAAAGGTTTCAAACCTATTTGACGAAAACCTACCGAAA AACAGCGAGTCTTATTGCTAACAGTTGTAAAGCAGTTGCTATGTTGACTGTCCCAACGCTATCACAGTGGCACATTGATA ATATGTACGAATTTGGAAAACATTTGGGAATGGCATTTCAATTAATCGATGATGTGTTGGGACTTTGTAACTGAATGANG C


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1210211: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12102112330500AA559804MC250472.NA3TBRI-Saber-cercaria-A


Date: 22:10:3 on Fri 17 Nov 117.