EST 1210215 is a singleton


Sequence

>1210215 (1 EST) Length=317 GAAAAACTTAATAATTGATAAGAAGTGCTGACTTGGATTACTACTTCGAGTACTAGTTAACTATCAACAACCAAATGCCT AAATACAATATTAATAAAATTTGTTTAGTCTCAGTTAGTGTAATCTCACCAACTAATTGACCGTGACTGTCAGAACGTGC CTTGTCGTTAAAAAAAAGAATTGCAATTGAATTAGATCAAAAGTAAAAGTTGTGATGGGATTTGTTTCGTACACATCAGT TACTAGTATTTTCTTGGTCTGAAAAGTGGGGTTTATTATAGAAGAGACATCCGACTATGGCATACATTTTCGTCAGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1210215: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12102152330504AA559808MC250478.NA3TBRI-Saber-cercaria-A


Date: 16:56:36 on Thu 23 Nov 117.