EST 1210220 is a singleton


Sequence

>1210220 (1 EST) Length=256 TGTCTCATTCAATCGGGGAGCTTCGTTTCGGTGAATCATATCCTGGTCAAGGTTAATCCACTANATGGAACAAAACTGGC TGTACAAACNCACTCCCAGATGGTTATTTACTACTTAAAACTGGTACCGACTATGTATATCAGCCTTCNTCTANNTGAAA GCACCGTGATAACTAATCAATACTCTGCTACATGGCATTCCAAAGGTACGCCTCTANCTGGTGATGGTCAAGGGATTACC TGGTGTNTTTTTCAAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1210220: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12102202330509AA559813MC250487.NA3TBRI-Saber-cercaria-A


Date: 19:44:25 on Fri 17 Nov 117.