EST 1213906 is a singleton


Sequence

>1213906 (1 EST) Length=527 TTTGGAACTAGTTGTTGGTTGCTCGGTTACATGTTCAGCGCAATACATATATGGGCTCTGGAGAATATATCATTAGACGT CGACAGTATCGTTGTTATGTAGTAGAAATATGAAATGTTCCAGGTTTTATATCATTTGATTGGGATTTTAAAAAATTGAA AGGATGCTTTGAATTTCTTTGTGGTAAACTCGTATATATGGGCAACTTTCTTAACAGTTTATTCATTACAAATTTTAATT TTTCTTGCAGAAATGTTTTACTGTGTATTGGGTTTTTCTTTCGAGGAAATGAAAACAGGATTTTTTATACTGTCGCACAT TTTGCTTATTTTGTTCTTTCGCCTTTTCGCAAATGATCATTTTACCTTAAGCAGAATCTACTTTTATGCTAAGCACGTGA AGTAGGAAGTCTTATTGTTATCTCCTGTTCTTTATCTAATTGTCGGATAGATTTTTCTTGAAAAATGATATTTCCATTGT GTTGCCTTCATTGCATTACAGCGGATTTATAGAAGTCATAATGCTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1213906: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12139062334988AA563523SWMFCA2478SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 11:55:55 on Wed 22 Nov 117.