EST 1213933 is a singleton


Sequence

>1213933 (1 EST) Length=673 CTTTGAGCCGCGACGTATATTTGGTGTCACAAGCCTCGATGTTGTGGGANCAGCATNATTNGTTGCTGGAGCCAAAGTAT TGGCCAAGTTTTGTTGNAAACTTCAAGAAATATATGTGTGATATGGTGATTTTTTTTCAACATACTGTCAAGTAACACTG CTATTTTATATCTAATTTTCTTTTAGAACCTAGATGCTGAGGAAACAGACATACCCGTGATTGGTGGCCATTCTGGGATT ACCATCATTCCGCTTCTTTCGCAAGCGAAACCATTCTGTAAGTTTTCGAATGATGAAGTGAAGAAACTGACAGAACGAAT CCAGAATGCTGGAACGGAAGTTGTGAAAGCAAAGGCTGGAGCTGTAAGTTGTAGATTCTCTTTTAGTTAGAACTGAGTGA AACGAATTTCCGACGGTCTTAATTAAAGAGTATGTCATCATTCACTTCATTTCCTTTATCTACTCTATTCTTTACTTAAA TTCATTTTCATTTTTTTCTTTACTCTATTACTTAATTCCCACCGTTGAAATTTTTTGGGTATTTGCTAATATTAATTTTC CTGAATTGGAATAAAAAATCCGACTTTATGGGAAAAAATATTACNTTTTATGAAAATTTTATGTTCCTGGGGATAATGTT GCCCGGTTAAGAATTTATTTTATTTACAAAAGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1213933: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12139332335015AA563550SWMFCA2527SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 17:50:45 on Tue 21 Nov 117.