EST 1216534 is a singleton


Sequence

>1216534 (1 EST) Length=192 GCCATGGCTGCTTTAAAAGTTTTGGAAGAGGTTCATTTAGCAGAACATGCACCAGAAACTAGGTGAAATCTTTCATCATG AACTGAGTAGACTTCAAAATCTGTCGTTGAATTATATCGTGGTAAAGGTCTTTTAAACCGCGATTGTAATTCGTCAAGGA TTTAATGCGTGGGATGTTTGTTAACATTACCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1216534: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12165342338783AA566151MA3AS037.AASS. mansoni adult Lambda Zap


Date: 19:9:36 on Thu 23 Nov 117.