EST 1216536 is a singleton


Sequence

>1216536 (1 EST) Length=159 AATGAGTGGGAAGTGGTCATTTCGCAGAGACTAGGTCCAAGACTAAATCTAATGTAAACGAGATATTCTACGATCTCGGT CGTCAAATTAATACAAGACACCCAATCCTACTTCAAAGTCATCAGGAGAAGGGAAAATTACTACTGGTCTCTGGAACAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1216536: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12165362338785AA566153MA3AS041.AASS. mansoni adult Lambda Zap


Date: 10:5:53 on Fri 24 Nov 117.