EST 1216537 is a singleton


Sequence

>1216537 (1 EST) Length=153 CTACGACAAAGTAAAAGCCAAATCAAATCATGAAATATTCCAATAACTCGTGAAGAAGTAACATAGTATATACAATCAAA TTGATAAATCACATGGAATTGTCTAATGGATAGTCTATTCGAAACTCTGCAAATCTCGCGAGTAGTGTTCTTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1216537: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12165372338786AA566154MA3AS043.AASS. mansoni adult Lambda Zap


Date: 21:58:36 on Fri 17 Nov 117.