EST 1216538 is a singleton


Sequence

>1216538 (1 EST) Length=257 GAGCATAGTCTTTGAGTTTTTTTTTTTTTTTTTTAATGATTAGAACATTTTTATTTAGCACGAATTAACAAAAAAAGATG AAAGGGACTTGATTGCACAGTAAAATGGAACTTTCCAAAAACATCCCTAAACCATCTGGTAACAAATAACTACCTGTTAC TCATCTTTCGGGGTATGTTAGAGTGATTACTATTAGTTACTAGGAAGCATTAGATAAGCATAATCATACATCAATCAATT AGTTCATCAAATGATAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1216538: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12165382338787AA566155MA3AS045.AASS. mansoni adult Lambda Zap


Date: 12:35:32 on Sun 19 Nov 117.