EST 1216541 is a singleton


Sequence

>1216541 (1 EST) Length=186 GCATGAAGGACACTTGCCTGTCGATCGCGCAGTTGTGCTCTTTGAAAGCCTTTATAAAAAATGATGGATTAATTCTCGAA GACACCTTCATATTTCGCCCAAGAATCTCTTTCCGCTGGGGTGCAGTCAGGTGCTTTTCAATAGTACAAATATACCCGAC TTCGAAAGACCAAGGCTTTCACAGCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1216541: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12165412338790AA566158MA3AS047.AASS. mansoni adult Lambda Zap


Date: 12:5:38 on Wed 22 Nov 117.