EST 1216542 is a singleton


Sequence

>1216542 (1 EST) Length=187 TATGATTCAGGATAAATGTTTGTCTCACGGGCTCCATCTTATCCTACTGGATATGCCTAATCCACCTTATCCTAATTTTA ATAAAACCAATCTAATATAAATGTGTGAAACATAAACTTTGATTAATATATAACATCTTTACATCAGAGGAGCTTTAATA CTCTACTTCAAGACTAACACAAATCAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1216542: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12165422338791AA566159MA3AS048.AASS. mansoni adult Lambda Zap


Date: 14:21:42 on Mon 20 Nov 117.