EST 1216543 is a singleton


Sequence

>1216543 (1 EST) Length=249 GGAAGCATCGTGGCTTAAAAATATTCAAAAACATCGAACCCCATATCCAGAAATATTTTCCTTATCACAACGCTGAGCTT GGAGGTATTTCCCCAGCATGCTAGTATAACGGGGAAAAAAGCCAAAGTGCCAAACGATTATGCAATTGGGAAATAGTGCC GTTTTCACAAAGTTTAACATCGTCATTCCAGATATTGTAAAGGTCGCTTCTGACAACGACTGTTTGATGTTCTGAGAGTA TTTATAACA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1216543: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12165432338792AA566160MA3AS050.AASS. mansoni adult Lambda Zap


Date: 19:16:34 on Thu 23 Nov 117.