EST 1216545 is a singleton


Sequence

>1216545 (1 EST) Length=151 GAGAATGAAAGCGATTTCTTTTTTTATGGTCATAACTGATATACAAGCCTGTCAAACATTTAACTTTCTTTAGTGCACAG CCTTCTCTGTCTTCTGGACAGATAAATTTACAAATGAGAGACAATGATTAAGACTTTGCACAGATATTGAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1216545: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12165452338794AA566162MA3AS049.AASS. mansoni adult Lambda Zap


Date: 17:16:21 on Fri 24 Nov 117.