EST 1216550 is a singleton


Sequence

>1216550 (1 EST) Length=171 AAAGACAATGTCAAGTTTAAGATCAGATGCAGTCGATTCCTTTATACGCTTGTAGTTGTGGAGAAGGAAAAAGTTGGAAA AATCAAGCGGTTCACTCCCACCAAATCTAACTGTGAAGGAACTGTAATATGTTGCTTTTAATAAANNTTTCTATATATTG TTTTTTTTTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1216550: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12165502338799AA566167MA3MA135.AA3S. mansoni adult Lambda Zap


Date: 1:33:7 on Sat 18 Nov 117.