EST 1216555 is a singleton


Sequence

>1216555 (1 EST) Length=167 GTGGATTTAATATCATAAATACTTCGATTCTGGAGACTACAATATGGCAAGAGCAAAGATTTTGCAGCAGCAAAAGCATG TACTCCCTCCCCAAACAGAAGAAGCTATTCTTCATGAATCGACAGGGGAAACTATGGCTACTCTTGACAGTGTACCTTCG AGTTCGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1216555: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12165552338804AA566172MA3MARO3.AA3S. mansoni adult Lambda Zap


Date: 21:10:49 on Fri 24 Nov 117.