EST 1216557 is a singleton


Sequence

>1216557 (1 EST) Length=165 TACCTGAAGATGTTAAAGATTGAGAGATGGGTAAATTGGTACGTATCGATTCAGATCATTTATATATAAGTAAACCAATG AATCCTTCTGATCTGTCGTATACTAGTATTGTTAATTTATTGAAAATTTATCATTATGTAAACAGTTACCTGTGAATACC AATAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1216557: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12165572338806AA566174MA3MARO4.AA3S. mansoni adult Lambda Zap


Date: 21:12:15 on Sun 19 Nov 117.