EST 1216562 is a singleton


Sequence

>1216562 (1 EST) Length=128 GATTATAGTATTTTCATGTGGCGACGGTAGACGTGGATGTATTCAAAGTTAGGAGATCAGCTGATAAATTTATGTGGACC AAATATAGAAAACGGAAAAGNACACCTAGTAGATGAATAAATTTATAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1216562: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12165622338811AA566179MA3MARO9.AA3S. mansoni adult Lambda Zap


Date: 9:4:1 on Tue 21 Nov 117.