EST 1216572 is a singleton


Sequence

>1216572 (1 EST) Length=150 TACTTTCGATCACCCCCCCCACACTGCCTTACATATACACACACACGCACATACCTTTTTTCATGTAATCTTCTCTTGTT TATTCGATTTTGTTCATTCATCATTCGTCAATGCATAAAGTTGAAAAAAGGATACAAACTAATAACAAAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1216572: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12165722338821AA566189MA3MR061.AA3S. mansoni adult Lambda Zap


Date: 12:28:6 on Fri 17 Nov 117.