EST 1216575 is a singleton


Sequence

>1216575 (1 EST) Length=147 CCAAGCATAGATCGCATTCGAAAAAGCATAAAAATTCTCATTCAAAAGAACGGAAACACCATCATCACCATTGATAATAA ACAACTATTACGTAATGGATTAAACTGTTCTGTACATAAGTATATATATAAACACACTGTTATCTAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1216575: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12165752338824AA566192MA3MR066.AA3S. mansoni adult Lambda Zap


Date: 0:30:17 on Fri 24 Nov 117.