EST 1216576 is a singleton


Sequence

>1216576 (1 EST) Length=199 TATCCTCTTGCATGGCTCTTTTATGATGTACCAGCTAAGTAATCACAATGAATATTTTGTTCACAACATTGTATAAATGA TTTTGTACAATGTTTTAGTTGTATCTAAACAACATAATAATGATTATTACTATTATTATCATCATCATTAGTAGAGTGAA GCTTATATATATACTACTTATATATATATATATATATAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1216576: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12165762338825AA566193MA3MR067.AA3S. mansoni adult Lambda Zap


Date: 4:2:7 on Sun 19 Nov 117.