EST 1216577 is a singleton


Sequence

>1216577 (1 EST) Length=138 CGGTATTCAAAGGAACTTCATTTATACTAGTTTATACTATTCATATATATAAATATCTTAATTTTTCCTTATTTATTGTT TTCCTGTTTTTTTTTCTATAGAAATTTGTCAGTCACCTTCGAAATACTTTATCAAAGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1216577: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12165772338826AA566194MA3MR068.AA3S. mansoni adult Lambda Zap


Date: 12:45:7 on Fri 17 Nov 117.