EST 1216580 is a singleton


Sequence

>1216580 (1 EST) Length=201 CTTACATTATTTCTGTTTCCATCCCTTCAATTTTTAGATTTGTTAATTTCATTGAATTTGCATGTTTCGTCTTTGTTACT TTGTACATGGATAAATCAAAATTTGCAGCAAACATGTTGTCTAGTCTTGTTTCTGTACCGGATTATACTGTTTATACTCA TTTTTGAAATGTATTCATGATATTGTAACTATGACAGTTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1216580: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12165802338829AA566197MA3MR062.AA3S. mansoni adult Lambda Zap


Date: 12:5:58 on Mon 20 Nov 117.