EST 1216581 is a singleton


Sequence

>1216581 (1 EST) Length=165 TGAGCAATATTTTGATAGTTATGGATATTTCATTTCTTGTATTTGGAACGTTCCTGTTATTTTAAACAGTCTACTAATTG TTCTACTCCTTGTTTTACAGATCAACAGTTTAATAATTCAATCTAAACGGTTTCAAATTGCTAACGAAAAGCGATTAAAA ACNGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1216581: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12165812338830AA566198MA3MR070.AA3S. mansoni adult Lambda Zap


Date: 23:37:36 on Fri 17 Nov 117.