EST 1216582 is a singleton


Sequence

>1216582 (1 EST) Length=151 TTCAAGTAAAAACAACTGTTTCTCAAGAAAACGTATGCTTTTCTAAAGCATGTGATTTTTATTATTGGTCTTCTATTATC AGAATTCCCTAAGGAATNCTCGATAGAGTTGTTTCTCGTCTTTCTGGTCTTGCTTTTTCCATTTAANCTAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1216582: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12165822338831AA566199MA3MR071.AA3S. mansoni adult Lambda Zap


Date: 6:22:46 on Fri 24 Nov 117.