EST 1216584 is a singleton


Sequence

>1216584 (1 EST) Length=174 ACGATATGGTCCATATGGATGCGATACATTCAGTCAAATGGCCAGTGCACATGTTGTACACCGTTTTCCTGTAACTACTA CTACACTAATTACAAATAAACTACACGAAGAATCCAGTCAACATTTTGTTAATAATTCATATAAATGTTCATCAATGGTA CATGTAAATTCTTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1216584: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12165842338833AA566201MA3MR073.AA3S. mansoni adult Lambda Zap


Date: 12:4:16 on Wed 22 Nov 117.