EST 1216588 is a singleton


Sequence

>1216588 (1 EST) Length=254 CACGATGATGATGGCTTTCTATATATAAGCTACAGTGGGGGAAAAATTCTTTTCGGCTCTGGTTCATAGCCTTATATTTT TCAAAACAAGATATTTTTCTGTACTTGTGTTTTGAAGGTTTAGTTTAATATGAATATATACAAATTATTTTCAGCTTACG TTTGCTAACTTTAAATAGTTTCCTTTTTTCATCTATNCTCCAAAGCAACAATGTTGTTTACCAATTATGTGCTTTTTTAG TGAGCAAGGAGGTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1216588: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12165882338837AA566205MC3NE026.ACSS. mansoni cercarial Lambda Zap


Date: 18:24:56 on Sat 18 Nov 117.