EST 1216592 is a singleton


Sequence

>1216592 (1 EST) Length=272 GTCATATCAATTTAGAAAGTTTTGCTAATAAAATTGAAACAGCTTTACTTAAAATTATTAAGTCTAAGAAAGCATTAACT TCTGATATCGGTGTGTTCTTCATCTACAACTCAGTTCCAAGAAGCAGTTCTAGAACAAGCTCATATTTCTTAATTATATC ATACAAAGACTACTCTAACCTTTAACTTAAACAGTTATCTATTAGACATATGCTTTTGTATAGTAGTCATAGTTGAATCT AATTTAACTTATGACTAGTATTATAGTTCCTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1216592: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12165922338841AA566209MC3NE031.ACSS. mansoni cercarial Lambda Zap


Date: 4:21:10 on Mon 20 Nov 117.