EST 1216594 is a singleton


Sequence

>1216594 (1 EST) Length=200 TACTAATAATAAAATCATATTTATTGGTGCATTTGTTTTAGCTTTACAATATAAATTGTCAGCTTAATTCAAACAATAAA AGGTTAATTTTCACAACAACAACAACAAAAAACAATTTAAGTTACGTATTTTATTTAGTTACTTTTTTGTTAAATTTGAG AACCGATTGTTTTCAAAAACAGAAAGTCAATATTTTTCCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1216594: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12165942338843AA566211MC3NE034.ACSS. mansoni cercarial Lambda Zap


Date: 13:14:47 on Thu 23 Nov 117.