EST 1216595 is a singleton


Sequence

>1216595 (1 EST) Length=227 GGCATTACGGAACCTAGTTAGTCCTTTTAAAAATACGTCTGCTGAGAGTGATACAGGGCGCTTTCAAAATTATTTATCGC TCAAACCGATAATATCTACTATATCTCGACATGTTAACCAATGACCTTCCCGTGCTCGAACGTTCGGGGTTTNTTCAGCT AGTCTATGCTCCGGCGTTATAGTNTTCTGCCCTATTCTCCATGTTGTGGTTCGCGCCGTTTGCTTTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1216595: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12165952338844AA566212MC3NE032.ACSS. mansoni cercarial Lambda Zap


Date: 8:43:43 on Fri 24 Nov 117.