EST 1216598 is a singleton


Sequence

>1216598 (1 EST) Length=138 CGCTGAAAAGTTATTACCCCACTATCGAAGATAGCTATCGGAAGAGGGTTGAGATTGATTCCAACAATCAATCTAGAGAT CTAGATACAGCTGGAACTGAGCAATTACGGCATGAGGGACTTTACAGCAAAAACNACA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1216598: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12165982338847AA566215MC3NE025.ACSS. mansoni cercarial Lambda Zap


Date: 2:37:29 on Thu 23 Nov 117.