EST 1218494 is a singleton


Sequence

>1218494 (1 EST) Length=412 CTTGTCAGTTTACAGACTGTAAATCAAGATGTATTATCTATATTCGGTATTCAAGCTATCTACGAGATATTTGTAGAATT CATCCTATCTTAAAATTATTAACCAATTCTCCTGATGTTATTTTACAACAAATCCATTATATTCTAATTTACAAGGTCCG TTAAATTCTATTTCAAATAATTTAATTAAATTATGTGATACATTAACTAGAAAATCACAAATTAAACGTGAAAATAAATC CGACCTGAAATTAACTAATAATCAATATTTAAAGAAAACTAAACATAAGAATAGCGGTAGTAGTAACAATCGACTAACAG AACAAAATAACCTAGAAACTAATAATATTATCATGAAAACTTTTCCCAGAATCTTGTTATTATCGAATATAAAAAAGCAC ACACACACACAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1218494: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12184942341110AA568098MU000011.Y2FSmL


Date: 17:13:38 on Wed 22 Nov 117.