EST 1218495 is a singleton


Sequence

>1218495 (1 EST) Length=358 ACCACGTTTGCTCACTTAGATGCTACCACTGTCTTAAGTCGTGCAATTGCTGANTTAAGTATCTACCCCGCTGTCGATCC TCTTGATTCTAACAGTCGTATTCTGGATCCTAACATTGTTGGCGAAGAGCATTACTCCGTTGCCCGTGGANTNCNAAAGA TCCTTCAGGAAAATCGCTCTCTGCAAGATATCATCGCTATTTTAGGTATGGATGAACTGTCAGAAGAAGATAGATTGACA GTTTCCCGTGCTAGAAAAATTCAGAGATTTTTAAGCCAACCCTTCCAAGTACANAAGTGTTTATCGGTCGCGAAGCAAAT TGGTGTCTCTGAAAGATCTATTAAAGTTCAAGATGATC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1218495: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12184952341111AA568099MU000014.Y2FSmL


Date: 23:41:48 on Fri 17 Nov 117.