EST 1221230 is a singleton


Sequence

>1221230 (1 EST) Length=680 CTTCATTAGAATTTGGTGATTATTAGTGGTATAAGTAGATCAATTTTATCTAGTAATTGTATATATCTAGGCTTGAAGAA TAGTTTCGAGTAAGTCGGAGAGGGGTATCATACATTTTTAATTTTTCCTCCCCTTAGTTCCTAGTTCTATAGATTTGATT ATACGGAAATTCTCCTAGAAAGTTCTGGCCTCTACCACCACATTTTGGGTCTCTTACTTCAGGGTTAAATTTTTCCCTTG ATTATGCCTCCTATTATCCCTTCCAATAACTTCCTACATCCGGAATATCTAAGTTTCTCCTCCAGGTAATGCTGCTTGAT TTTCATGTTTTGAATTCATCTAAACTAAGCGTGATACTTTTCCGAGCTTCAAGTAATGCAGATTAGTGATTAATATTTTG GTTTTTATTAATTTCAAAATTTCATTCAAACGATTTCTGCTTCTGTGCATCAGTATCAGCAAGAATCTATTCTGGTACTG CTAAAGTTTCAATTTACTGCAACTGCTGAAGTTTTTCACATATTTATCCTCTGAAAATTGGGTATCTTTTTCTGCTCGCA ATAAGGCAACCTTTGCGGAAATTCTGTCAAAAAAATCCTCCCCAGAATGGGGAAAAACTTACAAATTTTGATATTCCGAA AACACACCAATCCTTCTAGTGTTACTTTTCNCAAATGACC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1221230: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12212302344724AA570834SWMFCA2594SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 14:10:47 on Fri 17 Nov 117.