EST 1221234 is a singleton


Sequence

>1221234 (1 EST) Length=930 GGCTGCANGANTTCGGCANGAGGAATTTGTNGTACCTGATGAAAANGGCAATAANCTANATGACATACCGCTATCAATTA TATCATCAGCGAAAAGTTTGTCTCAATTGCGAGTTCCACCTCCACCACAAATGGAAATGAAAGAATGGGAATTGATGAAC TATCGTCGAGCAATAAGAGAATGGCTTTTGCGTCGTGAAATGTTCAGAAGACGAATGTTAGCTGAAATGGAACGAGAGCG TCAAGAAGCAGCGGAGCGCAAAATGTCACAATTTATTATGGGACTTCAACTACAGGAACAACATGAATTACCACAAGTTG AACAATTACAATCAATGCTACAAATGCTTGCATTAGCACGAATGAATTCAATGCCAAATGCGCCATGGATGAATAATGTT CAATCATCAATGGATGCANATCAACGTAATGCGCCAATGATAACTATGATATCACCGCCTGTGCTAATACGTCGAATTCC TCCAATGTTTCCTTTCCTAACTCCCAAACAACTACCACAACNAGAACNACGAGAGCAACNACNACCACCGGGCAAATAAT TCCCATCAAATNAATGCCACCACCAATCCTGAACCCGAAGAAGAACCCATTATTCCACCCNATTGGGGATTTAAANTTCN GTTAAAGCCCAACTTTACNCCGGNNGCAAATTCNGTGAAGANTCTATTTAATTNGGNCTGAATTTGGGAGCNNAAAAAAA ATACCNGGTTCCCNGTNCCCGTNTCTGGTTGTTGANTCAGCCAGTTNCCATGGAACCCTTGAATGGAACNCCCAAACCGT GAAATTTTNCTTTAAAAGAANTACAAACCNTTNCCGGAAGCCCCCNCCANTTTGGAGCNGAAACGATTTGAATCNGACCN CCCNAATTNAAAAAGGAAAAAANTTGGGGTGGCGGAATNCCATGNCAATG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, Processing,


Cluster Information for 1221234: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12212342344728AA570838SWMFCA2599SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 9:45:56 on Fri 24 Nov 117.