EST 1221242 is a singleton


Sequence

>1221242 (1 EST) Length=468 CGGCACGAGAAACAATTGCCAGAGACAAAGAGAACACCTTACCACCCCAGGTCCACCTGCTACCGCCGCCGTCGGAAGAG CTGGCCCTAAATGAGCTGGTGTCCCTGACGTGCCTGGTGCGAGGATTCAATCCTGCAGATGTGCTGATACGCTGGCTGCA TGGAAGCCAGGAGCTGCCCCCTGAGGAATACCTAGTGTTTGCACCCCTGAAGGAGCCAGGCGAGGGCGCCACCACCTTCG CCGTGACGAGTGTGCTGCGTGTGCCAGCAGAACCTGGAAAGAAGGAGACCAGTACTCCTGCATGGTGGGACACGAAGCCC TGCCCCTGTCCTTCACCAGAAGACCATCGACCGCAACACGGGTAAACCACCAGCGTCAACGTGTCTGTGATCATGTCAGA AGCGGATGGCATCTGCTACTGACCACCTGCCCGCCCCACCCTTAAATAACTCTGTGCTCATGCCAATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1221242: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12212422344736AA570846SWMFCA2608SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 6:12:25 on Sun 19 Nov 117.