EST 1221253 is a singleton


Sequence

>1221253 (1 EST) Length=528 ACAACTTACGACTGTTATTGTATCGTCCATCATTTATTACTTCAGGTATAATGCAACCATTCCTAATTACTTTCCTGATA ATATCAACAACATTTGGACAAGATTTACCATTTCAAGCCAGTATAATCGGACCACAAATGCCATCATCGTTTTTTGGTTA CACTTCACGATATCGATCACCTTTAATCGGTGATTTGGATGTATTAAATTTCTTGAATAAAGGAATGATACCAACAAATC CTGGCTTAGATCTTCTTGCTCATGGACTTGGCTTTGGAGTAGCAGCTTTACGAGGACTTGGAATTGTATTGCAGGACAAT GAACAAATCGTAAAATGACACACCAGTGAGAAACATATTTTGGATTATTTCGTTCTCTTAAAATGAATAATTCAGAAAAC TGCAGCATACATCAATTGTACAAGAAAAATAACAATTGTATGGAACTATAGATCATTTAAAGTGAAATATACATTTTATA TGTTTAATAATGTTTTTCAATTACTGGTCATATTAAATAATATTTGAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1221253: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12212532344747AA570857SWMFCA2621SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 1:56:59 on Sat 18 Nov 117.