EST 1221281 is a singleton


Sequence

>1221281 (1 EST) Length=648 CACAATAGTAAAACTGGATGATAAAGATGTCCAAATGGATGAAGTAAGTATTACATTATTTAATTGTTTAGAGCAGTGCA TGTCATATTACCGATTATTTGGGATATGATTTTTCTTTTCTTGTCTTACTAGATATCTCTCCGTCATCTCTGTAACTTTA CTGCCGAAATAAGATAATTAATTTTATACTATTACTACACATTGCAGGATGCTACGGGAACTGAAGGAAAGGCAGTGTCA ACAGAAATAGAAGGCATCAATGATGCTATTGATAGTACTAGCATTAGCAGCAACAGCAGTGATGGTGGTACTTGGTTAAA AGANGATAATGTGGATGAAATATTAGGACATATAGGTTGAAATATCAATGCCGGAGAAAGAAATGAAGGTTTCAAACTGT TGCAGTCGAATTGACTTTTCAAGCTTTAATTTTACGTTTATTTANAAATTGCTTGCAGTTAGCAACACATCTAAAGATTA TATTTANGTGGCTTGTGTTACAACGGATTTTGCTATGCCANAACGTCCTTCCTTCCTTTAAGGCCTTATTTAATGTCTAA TAACNGGTACAGGATACACCGACTGAAATAAGTTATATTCCCCAGGTTAATTTCCCAGTCCAAAATTCCAAACNTGTGCC TTTTTACC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1221281: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12212812345178AA570885SWMFCA2650SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 8:55:42 on Mon 20 Nov 117.