EST 1221288 is a singleton


Sequence

>1221288 (1 EST) Length=745 GTTCTTCACTGTNTCTAANNNCCANGGGGGGTGGTNNAATCTTCTNCTNNGCNTCTCNTNNATTNNACATGAAACTTCCC ATCTACCTAATTTTGGTGCTGCTGATAAAATTGTTACAAATAATACTTATTCTGATATCTCAGACAGCTTTGATTACAAC AATTTTGAGCCATTGTTTGGCTCAGAATTTCCATCCGATCCTTCGCAGTTGATTGATTTCGATCAGTTGAGTGAAATTGA GGATATAAGTNGCAAAGAATCGATACCCGAGATCACAAATGCTCCTCATCCTGGCTTTTCAAACAGCCATGGTTTGTTGG GTCGCACTAATTTGGGCTCATTACTTGGTTCATATNCNGATTCAAATAGGAATGTGTGGAGAGATGCTAATGGAGAATTA AAAACCAATGATGATNAAGCACGAAATCCTATTATTAGANATGCTCCAAGTGGACTTCCTCCGCCACTTAATGTCGACCC GATGACATTATTACTATATGCACTTACCTGGTCCCAACAAAATGCGGTCCCGATCTATTTTCCCCAACTTACTCCTTCCC CCNNATGANACTTCCGATCAACNCGGAAATGGCGAACAAAACATTTNGGCAATAACNCTTCTCNGATNACTTGATGTTCC CNACTACCNGGGAAAATTCCCNTTGAACGAATCCGAAACCGATTAGAAAAAANTTTTTTTGTTCNTTACCCCGGGTGTTN TTTTTNATCCCNGGAAAATTTCCAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Processing,


Cluster Information for 1221288: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12212882345185AA570892SWMFCA2663SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 21:27:12 on Fri 24 Nov 117.