EST 1221301 is a singleton


Sequence

>1221301 (1 EST) Length=540 AAGATGACGAATGCGGTTTATTAAAATGCAAATTAAATAATACTCAAGAACAATTAGCAAAGCTTAAAGATGAATATGAC CAATTGTTGGAACAATTTCAAAGTAAAGAAAATGAAGGATTGAAATTGCAACAACAATTTGATCAATTATCATTGAATGC TACAACTGATGCAAAAATTGAGGAGCAATCAAAAAATATTCAAATTATGGAGAAAGAATTGGAAATGATCCGAGAAGAAA ATAAAATGTTGCATGAAGCAAATGAGAAACTTATACAAAAGTTTGTCAATAATGATTGTTAAGTTTAAATTTTTATAAAA TTAAAATTTATTGAAATAGATGAGTTCATTCACCTTTTTTCTTCTCTATTTTAAAAATTTAATAAACAAATTATTTACTG TTTATTTAAGTGCACATCCAAAAAAAAAATATGTGTGAACATAAAGCCNCGTGAAAAAATAATTGTGGGAAAAGTTTTTT TTCTCNNANTTTNGGGAAATTGAGAAGANTCCGGAATGAAATAAATTTTGNGGATATATG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 1221301: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12213012345198AA570905SWMFCA2719SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 17:54:18 on Fri 17 Nov 117.