EST 1221307 is a singleton


Sequence

>1221307 (1 EST) Length=641 CGACGGCACGAGAACAAACTAAAATTGTTGATGAGGACATGAGTTATTCTAGAAAAAAGAAAAGCAAAATTGTCGAAAAA TTAAACTCCTGAAATCTTGCATAGGAAATCATTTTTAAAGTTGAATAATAGAGAATTTGAGAAATTACTTGCTTTCGAAG ATTGATCTAAAAAATTTGAGAAAAGTTGCAAGTTGAATATATGATATGATAATGATTAAATGAATGTATTTGTACATAAG ATAAGAAAGTAACCAAGTATTTATTATGCGAAACGAGTAGTAATACTTAACACAATGAAATAATCAAGCAGCGAAGAGGA ATATTTGCGGGAAACTCAAACTCAAAAAATTTCTTGAAATAATGATTAAAGATTAAGGGAGTTTTTTCTTTTTTTGATTG AAAATTTATTGATGAAAGATAAATGGGATCAATAATGCAGTGAAAATATGCTATGACATTATTTATAATGTATGAAAATG TTAACAAATATTAGGTATGATATGAGATATTGAACTGATATTATGATACATGGANGTTTTAATAAGTTACAGATTANAAA CNAAAAACCGAAAGTTTNAGAAAATATCCAAATCCACATTATTTTGTTATTTACATTCCTCAAATTCCATTTATTTAGTT C


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1221307: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12213072345204AA570911SWMFCA2734SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 12:55:12 on Sun 19 Nov 117.