EST 1221310 is a singleton


Sequence

>1221310 (1 EST) Length=780 GGGATTCTAAAGGGTTTCCAGGTTAATTTCAGATTTTCGATTTTTTGTTCCAGTTGGCATAACTTAATTTTTTGTTTTTA GATTATTGTGCTAGGTAGTGGTGCTAAATATAACCGAAACATTACAACAAATGAACGTGCAGCAAGTGTTACGTTGTTTC ATCTAATACCCGAGATGACCTATGGAGTTAAAGTTGCAGCACGAAGTAACGCTGGTGTTGGTGTGTATCATGGTCTTGAA GCTGTCACAATGAGTAAGCTATTTAATCTTCAGGTTGTTATTATGAAAGGAAGCAAAGGTTGTTATTATGATTCATGATA TTATGTTGTTGAAATTTTGTTTTTTATTTAGTAAGAAAAAAGAATTATTTAGATGAAGCAACACTGCGANAACATATCCA GTTAATGAATGGGATTTCCTCCGGTGANCGTTTGCTACATATTATCAAAANGGCCTGGTTTATTGCTACACAGGAATGCT GANATGGATTACATTCNNTGGCCNCCTCACTTTTATATNGTGGAAANGGCGAAAATCCAAAGGTTAAACTGCNGGTTTGT TGTTTCNCCNGAAATCCCCNCCGGTGTTTTTGTTATAAATTGAACTCCCNACTCNGAATGTATTTTCTCCAATTTCCGCT CCAATATTCAACTGCTCCAAATCAANTCCATGCNANCNGTATTCGGTCATCTNCTTTTAACCTTAATTTNACTTTGTTTA ATTTTGGTTGAAAACATCAGTTCTGTGACGAAAANCGGATNTAANGTACNTATTAATCCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1221310: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12213102345207AA570914SWMFCA2741SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 17:50:19 on Fri 17 Nov 117.