EST 1221313 is a singleton


Sequence

>1221313 (1 EST) Length=718 TCTAACTTGAGTAATGAATTGTCTCGTGAAACAAAAGTTTCAACAGACGAGCAATGAAATAGTAACATCAATCATGGTTA CATTTAAAACAACGAATTTGTTGTTGTATGTATACCTTGGATATATATGTATATAATGATAGTGCAATCATAATGTATGT GAAATGCTCCGTTGTACTATTGGAAGTATGTTATTGGAATTTTATTGTATTGTAAAATGGAAATTTAAATTTTGCTAATA AGCGAAGAAAATCATGTATGAATGAAATTTTGAAATATAGATGAATGAATGAAAGAAAACATAGTACAACAATTTTTATG CATGATATATTTAAGATATAATGCATAATGTTTGTATGTGTTTTCTTATTCTTTTCATACATCTCCCCGATTGATTCTGT CGGCGGTTATATGCTTGTCTCAAAGGCTAAGCCATGCATGTCTAAGTTCAAATAAACCTATAATGGTGAAACCGCGAACG GCTCATTATAACAGCTATAATGTACTTGATGTTGATTATCCAACGTGGATAACTGTGGGCCGTTCTTANTTGGTGGAATG ATTTGTCTGGTTTATTCCGATAACGAGCGAGACCCTACCTACTAAATAATTACNGGGATAATTTTATCGTCCANACACTC CTAAAAAGGACAAGCGGGTGTTTAACCGCATGAAATTGAACAATAACNGGTCTGTGATGCCCCTAAAATGTCCAGGGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Processing,


Cluster Information for 1221313: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12213132345210AA570917SWMFCA2744SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 4:28:15 on Thu 23 Nov 117.