EST 1221318 is a singleton


Sequence

>1221318 (1 EST) Length=247 ATATTTGAGAACTGTCCAAGTGCAATAAATACTCAAATATTCGATGCATCTTAACTTGCACGCTGTGTTTGGAATGCCCC TATTTTCCTATACAACGATTTAACGTTTTCTTATCTTTTAAATGACGGGGTCAGTTAACATTACACTTCGCTTTTGTCAC AAATAACTTGGACACTTGTCAAGTATTTCGTCATGACTGTGATATATTTGATACGCGAAAATCTATCAAATTAAAGCAAA TGCGTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1221318: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12213182345215AA570922SWMFCA2751SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 1:39:17 on Sun 19 Nov 117.