EST 1221323 is a singleton


Sequence

>1221323 (1 EST) Length=650 NNCGGCCNGCTGGACTANNCGACCTAGATGGAATCATTTATGGTCGTGGTGCACAAGCATATGAAATCGATTGGTATTCN ATATGTTGAAGCAATACGACGATTATTTAAAATTAACCAAAATCAAAACAATTTNCTCCGAACATTACATCTTGTATGGG GTCCAGATGAAGAAATAGGTGGTGAANATGGAATGGANAAATTTGTTGAAAGTGAAGTATTTAAAAAATTANATGTTGCA TTTGCTTTGGATGAGGGATTACCAACAGATGAGGAAGCATTTAAAGTATATTATGCTGAAAGATGTCCATGGTGGGATTG TTATAAGTTGTAAAGGTGTAGCAGGACATGGATTGCCATTAATCGAAAATACTGCCAGTGAAAAATTGCNANAAAATAAT CAACNGTTTTATGAAATTCCGAGAGGAACNATAAAAACTCCTTGAATTAAACAAAGATTTAACGCTGTCCNATGTTATCT CTGTAAATNTAACAAAANTTGAGGGTGGAGTNCAATTGAATGTACTACCCACGGGAGATTAAAGTATGGTTCGATCNTCG GATACCANCAATGCCCNATTTTGAANGAATTGGAAAATCNCTTAGCAANTGGTGTACCNATCCGGTAGTGATGTTGACCT ATANCCTTNT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1221323: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12213232345220AA570927SWMFCA2760SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 14:13:21 on Mon 20 Nov 117.