EST 1235426 is a singleton


Sequence

>1235426 (1 EST) Length=876 GTTGCCATCATTGATTCGTTTAAAGACAATGAAAAAATTGTTGTACTGGTTACCGGTGCATCAGGTTATATAGCATTGCA CTGTGTTCAACAACTTCTAGAAAATGGTTATACGGTAAGAGGTACAGTACGAAGTCTACAAAACTCATCAAAGATTAGTT CACTTCGTGATCTGAAACATAGCTCAGAAAGGCTTGAATTGGTTGAAGCTGATCTTGAATGTCCGGATCATTGGCCAAAA GCAATTGAAGGATGCACATATATTCTGCATATTGCATCACCATGGCCTATTGTAGCTGATGAGACAACTATAAGAATTGC CAAGGATGGTACTTTAAATGTTTTAAAAGCTGCTGCTCAATGTAGTACCGTCCAGAAAATTGTCCTAACTAGCAGTACAG CTGCTATAAATGATGGTCATAAAAATGATGCTCGAGTTTTTGACGAAAATTGTTGGGGAAATTTGAATAGTAAACGAATT GAAAATTACAGTCGTTCAAAAATAATTGCCGAAAAAGCTGCATGGGAATTTTGGAAATCTTTGCCAGAAGCGTTACAATT CCAAAATTTAAGTACGAAAATCAAATATGTTTGTTAAATGGATTGAAGAAGATGGGAATGCAATCAATGTTCCACNAATC GAATGATTTTCCNGCATTTTTGAACANCGGTTATTTACATGGGATGATATCAGAAATCCTGCTTATTCCAATTGATGAAA AAAGAATCCATAACAAAATTCAGTTTGCCATAAAAATGATTGGTATGGATAANGAAAACATTCCTGCTAACNNCCCTCCT TATGCAANCNTGANAACNCGGACGTTCTANGATGGGCCTTCCCCGGAAAAAAAAAAAAAATGTCAAAANNCGATAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 1235426: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12354262369521AA584968SWMFCA2702SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 4:59:9 on Tue 21 Nov 117.